1.
Prevelance Of Intesrinal Parasitosis Among Children At Day Care Centers Of Lahors In Reation To Socio- Economic Srarus
by Amera Batool | Prf.Dr. Azhar Maqbool | Dr. Aneela | Dr. Nisar Ahmad.
Material type: Book; Format:
print
; Literary form:
not fiction
Publisher: 2011Dissertation note: Some intestinal parasitosis pathogen have potential is well known, many of them not shows symptoms, due to the body immunity and climatic element (Vinayak et al. 1990). While other shows like B. hominis and C. parvum. Persistent and acute diarrhea has been linked with the Giardia duodenalis and Entamoeba histolytica. Entamoeba / dispar, a protozoa having alike character with E. histolytica which is a not involve in causing diseases but proved symbiotic association in gut, not harms the other.
Children up to age of 3 years commonly found with anemia and iron deficiency due to malnutrition caused by high prevalence of parasitosis. (Kapur et al., 2001)
Cryptosporidium parvum within age of 5 years children gave highest prevalence rates in a community, among different parasites (Palmer & Biffin 1990). Cryptosporidium spp have been causative agent of persistent and acute diarrhea in many research works (Lima et al. 1992).
In developing countries intestinal parasitosis infection is a major health issue by promote health standards and controlling the carriers or vector, most countries have successfully reduced the rates of infestation. However, in developing countries geographic, socio-economic factors and natural calamity increase the health problems. Countries, which are geographically located in hot and humid areas along with poverty, unavailability of clean water, malnutrition, and high population density provide maximum chances for the development and high intestinal parasitic risk. Because of lack of sufficient research and attention of infectious and parasitic diseases in developing countries is the main problem hurdle to eliminating the risk of parasitic infestation.( Sayyari et al.,2005)
Pakistan estimated the intestinal parasitosis as the important public health problem. In developing countries intestinal parasitosis infection is a major health issue by promote health standards and controlling the carriers or vector, most countries have successfully reduced the rates of infestation. However, in developing countries geographic, socio-economic factors and natural calamity increase the health problems. Intestinal parasitosis is most familiar in children due to lack of hygienic condition. Physiologist and medical specialists are recommended that parasitosis infections delay children's growth, malnutrition, lost the opportunities of education and development. The under study carried out to record the prevalence of intestinal parasitosis within children at day care centers of Lahore and also to relate environmental factors with socio-economic status.
The basic purpose for collection of stool specimens were to examined the parasitic eggs, cysts, and larvae, by different methods like fresh smears method and Scotch tape method. Trophozoites of amoeba were examined in fresh smears. Oxyure eggs were seen in Scotch tape slides. The parasitic size was measured by ocular micrometry method. Formaline ether concentrate method was being done for finding cysts (Machado,1999 ; Lotphy 1990). Socio- economic and environmental factors were also is studied.
Of 174 children 56 children studies positive for parasitosis, 96 were males and 78 females. One or more intestinal parasites were identified in 40 (22.9% children) the most pravelent parasite were E. vermicularis 9.19% G. lamblia 6.89% E.histolytica 5.17% A.lumbricoides 2.87% H.nana 1.14% T. saginata1.72% T.trichiura 4.59% and E.coli 0.57% showed a low infection respectively
Availability: Items available for loan: UVAS Library [Call number: 1310,T] (1).
2.
Evaluation Of Adulticidal And Larvicidal Efficacy Of Zadirachta Indica (Neem) And Lantana Camara (Punch Phul) Extracts
by Asemah Anwar | Prof. Dr. Azhar Maqbool | Dr. Aneela | Dr. Nisar Ahmad.
Material type: Book; Format:
print
; Literary form:
drama
Publisher: 2012Dissertation note: Pakistan is one of sub-tropical countries and its climatic conditions favor parasitic diseases along with disease vectors including mosquitoes. Mosquitoes of genus Aedes are causing Dengue fever. It has become one of infectious vector born disease of world. Annually it is striking around 100 million people with dengue fever and about 5 Lac people with Dengue Hemorrhagic Fever (DHF), resulting in 5 % deaths per year. Current study was conducted to evaluate efficacies of plant extracts against dengue fever mosquitoes of Aedes genus. Study target was to search some safer alternates than that of chemical pesticides. Also exhibiting characteristics like less toxic to environment, do not induce resistance in mosquitoes, do not harm non-targeted organisms, would not be toxic to human beings and will have biodegradation ability. Study has evaluated indigenous plants extracts as potent larvicidal and adulticidal materials.
Mosquitoes were collected from different areas of Lahore and they were identified upto genus level only Aedes genus was identified upto species level, then Aedes aegypti was reared in laboratory to have F 1 generation, to have mosquitoes and larvae for testing the activity of plant extracts. Plant materials were collected from different areas of Lahore. Methanolic extracts of seeds and leaves of Azadirachta indica and lantana camara respectively, were extracted accordingly. Stock solutions were prepared from these extracts and then out of this serial dilutions were made. Experiment was performed in four groups A, B, C & D for both adults and larvae. Each group was representing total of 25 larvae/adult out of which one was kept untreated
as negative control, one with deltamethrin as positive control while two were provided with test concentrations.
LC50 and LC90 was determined by Probit analysis, using SPSS version 13.0 SPSS inc. 2004. lethal concentrations of A. indica mosquitocidal assay were LC50=30.44 mg/l and LC90=62.36 mg/l after 24 hrs and LC50=-9.87mg/l and LC90=59.102 mg/l after 48 hrs at ?= 0.05. X 2 value was significant for 24 h while for 48 h it was not significant. Maximum mortality observed after 24 and 48 hrs is 99% at 70 ppm. DMR test shows after 24 hrs., all treatment means are significantlt different from each other, from control and from mean of insecticide's mortality, control is significantly lower while insecticide treated group has significantly higher than rest.
after 48 hrs. treatments were significantly different from each other while treatment mortality at 70 PPM is significantly higher than insecticide treated group and rest.
Lethal concentrations for L. camara adulticidal assay were LC50=60.40 mg/l and LC90=113.61 mg/l after 24 hrs and LC50=48.20 mg/l and LC90=79.31 mg/l after 48 hrs at ?= 0.05. X 2 value was not significant at 24 h and is significant at 48 h. DMR test after 24 hrs. treatment, control and insecticide treated were significantly different from each while insecticide treated group has significantly higher than rest. After 48 hrs 4 and 5 treatment groups were found significantly higher than rest
Larvicidal assay of A. indica has shown LC50 =52.36 mg/ l and LC90=105.42 mg/ l after 24 h and LC50 =80.70 mg/l and LC90=145.73 mg/ l after 48 h at ?= 0.05. X2 values for both 24h and 48h were not significant. DMR test after 24 hrs. insecticide treated was significantly lower than all above treatment groups. Treatment group 7 has significantly higher mortality than all other. After 48 hrs. there was not any significant difference.
Lethal concentrations for L. camara LC50 =100.76 mg/100 ml and LC90=198.22 mg/100 ml at24 h and LC50 =61.27 mg/100 ml and LC90= 122.45mg/100 ml after 48 h at ?= 0.05. X2 value for both 24h and 48h was not significant. DMR test after 24 hrs. shows insecticide treated group i.e. 8 is significantly lower than all treatment groups except 1 which is at lowest treatment. After 48 4, 5 and 6 had came to same activity level no significant difference was found and were higher than all others.
Conclusion:
Hence it is concluded that crude plant extracts can act as potential Adulticide / Mosquitocide and Larvicides, though these are required in higher concentrations than that of synthetic insecticides and purified botanical products, but they have advantage of posssessing less resistance presentation and safe for aquatic life. It is also concluded that chemical insecticide used i.e. Deltamethrin has higher efficacy as adulticidal with drastic effects on environment and other beneficial insects. But it was found least effective as larvicidal compared to crude plants extracts. It is suggested that plant extracts can prove a better, safer and cheaper alternate these should consider as a better alternate to control most lethal disease of present time i.e. Dengue fever by eradicating its vector i.e. Aedes aegypti mosquito.
Availability: Items available for loan: UVAS Library [Call number: 1475,T] (1).
3.
Isolation Of Local Strain Of Toxoplasma Gondii Through In-Vivo Cultivation In Mice
by Rahim Gul | Dr. Muhammad Imran Rashid | Dr. Aneela | Dr. Nisar Ahmad.
Material type: Book; Format:
print
; Literary form:
not fiction
Publisher: 2013Dissertation note: Toxoplasma gondii is an obligate apicomplexan, intracellular, parasite that infects all warm-blooded vertebrates, including mammals and birds. Human beings can be infected by ingestion of oocysts from cat faeces or through the consumption of meat containing Toxoplasma gondii cysts. Thus, food animals can be the source of transmission of Toxoplasmosis in human population especially among people who consume undercooked meat in the forms of barbecues, beef steaks, kebabs, burgers and shawarmas. Oocysts of T. gondii from cat faeces were identified by using direct microscopy and flotation technique. The positive oocysts were confirmed by micrometry having diameter of 9-13 ìm. The oocysts were then sporulated in aerated condition. After sporulation oocyst were inoculated in Swiss albino mice for in-vivo culturing. After 56-70 days brain tissue was collected from infected mice and subjected to DNA extraction and PCR amplification. Similarly DNA was also extracted from sporulated oocyst for copro-PCR. Out of 200 faecal samples only three were found positive for Toxoplasma gondii through direct microscopic examination and flotation technique. From positive faecal sample and brain tissue DNA was extracted by QIAGEN mini stool kit and QIAGEN DNA mini kit. After DNA extraction the samples were examined through PCR by using specific Toxoplasma gondii B1 gene primer having 529 bp size. Two hundred faecal samples were examined for T. gondii using direct microscopy, flotation technique, bioassay and polymerase chain reaction. Out of 200 samples 3 (1.5%) were found infected through direct microscopy and flotation technique. Toxoplasmosis was more prevalent in adult cats (1.65%) as compared to young ones. Prevalence was also found high in females (2.08%) as compared to males. Similarly healthy cats have higher prevalence rate (1.30%) as compared to diseased ones. A further confirmation was done through polymerase chain reaction and brain tissue cyst Bioassay give 1 positive amplification while Copro-PCR gives 2 positive amplifications. Therefore it can be concluded that the copro-PCR is can be used for the confirmation of Toxoplasma oocysts from cat faeces and tissue cysts from bioassay in mice. Therefore, we propose that the copro-PCR can be used as the new gold standard for determining potential cat infectivity and tissue cysts from bioassayed mice or contaminated meat samples of livestock.
Availability: Items available for loan: UVAS Library [Call number: 1778,T] (1).
4.
Prevalence And Treatment Of Ovine Fascioliasis In And Around Rawalakot A.J.K
by Anisa Mushtaq | Dr. Nisar Ahmad | Dr. Aneela | Dr. Haroon Akbar.
Material type: Book; Format:
print
; Literary form:
not fiction
Publisher: 2014Dissertation note: Fascioliasis is a wide spread parasitic disease of ruminants causing great economic losses in terms of decreased milk and meat yield and predisposing to many bacterial infections. Looking the importance and utilization of the small ruminants in our country and the substantial losses because of the Fascioliasis this study was designed to study the prevalence and treatment of Fascioliasis in and around Rawalakot Azad Kashmir.
For this purpose a total of 300 Ovine faecal samples were collected from different areas of Rawalakot. Faeces were collected from sheep of various age, breed and sex. Faeces of each sheep were examined by direct smear, sedimentation and flotation techniques. Positive animals were selected for therapeutic trials.
Out of 300 faecal samples 101 were found positive for Fascioliasis. Overall prevalence was 33.6%. Sex wise prevalence was also studied and it was found that out of 75 male sheep 23 were found positive while out of 225 female 78 was positive for Fascioliasis. Prevalence of Fascioliasis was 30.6% in male and 34.6% in female. The prevalence was also studied age wise and three groups were made. Sheep in first group were less than 1 year of age, out of 25 sheep 4 were found positive and prevalence was 16%. Sheep in second group were between 1-2 years of age, out of 156 sheep 39 of this age group were found positive having a prevalence of 25%. The sheep included in third group were greater than 2 year of age, out of total 119 sheep in this group 58 were found positive for Fascioliasis with prevalence of 48.7%.
For therapeutic trials 80 positive sheep were divided in to 4 groups A, B, C and D. Group A and B were further divided in to three sub groups A1, A2, A3 and B1, B2, B3. 10 animals were placed in each sub group and group C and group D. Animals in groups A and B were treated with herbal extracts. Fumaria parviflora was given to group A animals and Caselpinia crista to group B animals @ 60, 70, 80 mg /kg body weight. Animals in group C were treated with Oxyclozanide @ 10 mg/kg body weight, while animals in group D were kept as infected untreated control. The efficacy of single dose of Oxyclozanide was found 100 percent on 18 day post treatment where as the efficacy of single dose of Fumaria parviflora at 60, 70, and 80 mg/kg body weight was 51.6%, 54.6%, 59.4% on 18th day post treatment, While its efficacy at same dose level after second dose was 79.6%, 82.8%, 86.9% on 21st day post treatment and 83.8% 87.5%, 91.8% respectively on 28th day. The efficacy of single dose of Caselpinia crista at 60, 70, and 80 mg/kg body weight was 31%, 41.42%, 58.7% on 18th day post treatment, while its efficacy at same dose level after second dose was 47.36%, 58.85%, 82.55% on 21st day and 51.3%, 63.2%, 87.3% respectively on 28th day.
At the end of research data on prevalence was analyzed by chi square test P < 0.05 was considered as significant whereas data on therapeutic trials was analyzed by using ANOVA in this case p < 0.01 was considered as significant.
From this study it was concluded that Fascioliasis is significantly prevalent in sheep in and around Rawalakot. While Oxyclozanide is most effective drug against Ovine Fascioliasis. The outcome of this study will help the veterinarians and farmers in the field.
Availability: Items available for loan: UVAS Library [Call number: 1789,T] (1).
5.
Safety Level And Efficacy Of Controlled Release Urea On Performance And Health Status Of Nili Ravi Buffalo
by Muhammad Mobin (2007-VA-156) | Prof. Dr. Aneela Zameer Durrani | Dr. Jawairia Ali Khan | Dr. Nisar Ahmad.
Material type: Book; Literary form:
not fiction
Publisher: 2014Dissertation note: Livestock is one of the major sectors of Pakistan’s agrarian based economy. During 2013-14, it contributed almost 55.4% to the agricultural value added and 11.9% to national GDP. In the livestock sector, gross value addition increased from Rs.735 billion to Rs.756 billion; revealing an increase of 2.9% as compared to the previous year. Livestock is considered the best tool for poverty alleviation, as most of the livestock are owned by poor people who live in the rural areas. Pakistan is 4th largest Milk producing country in the World. Its Cattle Population is 33 Million while Buffalo Population is about 30 Million (Economic Survey of Pakistan, 2013-14). Despite large population, per animal production is very low.The low productivity of these animals is because of poor quality feed stuff. Their productivity can be enhanced by feeding them balanced ration.
Growing human population urges the intense need to explore the present livestock resources to fulfill the animal protein requirements. It is impossible unless optimal fodder and forage production is ensured. In Pakistan, low quality fodders coupled with the reduction in the fodder area are the main constraints, which adversely affect the animal production. In future, it is expected that ruminants will be more dependent on forages because readily expanding human population will have direct competition with livestock for edible grains.
Among the problems facing the livestock in the tropics is the low protein tropical grasses and the high cost of alternate sources of protein such as the Soybean and other oil cake. A portion of nitrogen in feeds for ruminants may be provided in the form of simple nitrogen compounds (or0non-protein0nitrogen0NPN) 0that are degraded in the0rumen to release ammonia (NH3), which is used by rumen microorganisms to produce amino acids. The amount of NPN that can be provided is limited. The product which is the urea, when it releases NH3 faster than it can be converted into microbial protein excess NH3is absorbed through the rumen wall, causing toxication.
Protein is often0the0major0limiting0nutrient for ruminants. Protein-rich leguminous forages and vegetable protein supplements are usually expensive or not available.The manufacture0of0urea and0ammonia for use as0fertilizer has been greatly0expanded in0many countries, 0but these compounds0could0not be0used more0widely in feeds for0ruminants. The ability0of0the0micro-organisms0in0the0rumen0of0cattle0and0sheep0to0utilize0urea0sources0to form0true protein0that0can0be converted0to meat0and0milk0by the0animals, represents0an important0contribution0to0man's0food0supply.0Maximizing0microbial0protein0synthesis0and flow0to0the0duodenum0by0reducing the0recycling of0microbial N in the rumen offers a potential0to improve0the production0efficiency0of ruminants.In general, the efficiency of utilization of dietary N by cattle is relatively low under normal production conditions (Castillo et al, 2001) with a global average N-efficiency in cattle estimated at 7.7 % (Van der Hoek, 1998). Urea is used rather inefficiently for production of protein products (Broderick et al, 2009) and due to its wide use in ruminant feeds, may0be0partially0responsible for0the poor N efficiency0in cattle. Low efficiency of utilization of dietary urea has been attributed to the rapid0hydrolysis0to0ammonia (NH3) in0the0rumen0by microbial0enzymes which occurs at a higher rate than its utilization byrumen bacteria, leading to ruminal accumulation and absorption0of0ammonia andsubsequent excretion of0urea in the urine (Golombeski0et0al., 2006; Highstreet0et0al,2010).Furthermore if used above threshold level, the main problem with urea usage is that it can cause toxicity and even death of the animals. Farmers hesitate to use urea as a source of protein, resulting which his animals remain underfed and never achieve the peak production.
Urea0poisoning0is0one0of0the0more0commonly0suspected0toxicities0of0cattle. Urea0is0used as0a source0of non-protein0nitrogen0in feed0supplements.In ruminants,0nitrogen0from0urea is released0in the0rumen as0ammonia0and0can0be0used0by0rumen0micro0flora0to0synthesize protein. This0protein0thenbecomesavailable0to0the0animal0through0the0normal0processes of digestion0and0absorption. However,if0 more0ureaisconsumed0than the rumen organisms can0metabolize, the0ammonia0is0absorbed0from0the0rumen0into0the0blood.Ruminal pHbecame alkaline due to the hydrolysis of urea to0ammonia (Buffalo Bulletin,2002). The ammoniaisthen0converted0back0to urea in0the liver and is0the0excreted by0the0kidneys. This0pathwaycan easily be0overwhelmed,0when excess0ammonia0and urea0circulate0in the blood,0causing0poisoning. Poisoningcanoccur0rapidly0from a few0minutes0to four0hours after0consumption. Suspect0urea0poisoning0if cattle are found0dead close to0the0supplement (H. Parkes et al. 2003).Slow release urea has been shown to affect ruminal fermentation characteristics.Most notably, slow release urea is intended to0reduce0the release rate0of NH3 within the0rumen. Most reports on controlled release urea have shown a reduction in ruminal NH3 concentration when measured (Cherdthonget al, 2011; Huntington etal, 2006b; Taylor- Edwards0et0al, 2009d). This is the reason why slow release urea presents a lower risk for ammonia toxicity than feed grade urea. Ruminal NH3 concentration is often related to ruminal pH, as the protonation of NH3 toNH4+ when ammonia from urea ionizes, can result in an increase in ruminalpH. Consequently, there are reports of higher ruminal pH for animals fed urea than those fed slow release urea (Cherdthongetal, 2011; Taylor-Edwards et al, 2009b)
Availability: Items available for loan: UVAS Library [Call number: 2216-T] (1).
6.
Expression, Purification Of Toxoplasma Rop18 Recombinant Protein And Its Antigenic And Immunogenic Trials In Mice
by Habibun Nabi (2010-VA-69) | Dr. Muhammad Imran Rashid | Dr. Nisar Ahmad | Dr. Aneela Zameer Durrani.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Toxoplasma gondii is an obligate intracellular, apicomplexan parasite that infects all warm-blooded vertebrates, including mammals and birds. Human beings can be infected by ingestion of oocysts from cat feces or through the consumption of meat containing Toxoplasma gondii cysts. There are potential vaccines candidates among which ROP18 has its major role in host gene expression along with the modulatory effect on key regulators of the host immune system. Therefore in this study, ROP18 sequence was amplified from local T. gondii strain, recombinant ROP18 was expressed through recombinant DNA technology and this recombinant protein was then tested for its antigenicity and immunogenicity in a mouse model. Approximately 200 fecal samples were collected from domestic, wild and stray cats in and around city of Lahore, Pakistan. Oocysts of T. gondii from cat feces were identified by using light microscopy and flotation technique. The oocysts were measured by micrometry having diameter of 8-10 μm. Out of 200 fecal samples, only three were suspected for T. gondii through direct microscopic examination and flotation technique. From 3 fecal samples, genomic DNA was extracted using a stool DNA extraction kit. After DNA extraction, the 3 samples were confirmed and characterized by PCR and nested PCR by using B1 gene and SAG2 primer sets. Reference DNAs (RH) of toxoplasma were kindly provided by Dr. Henrik Vedel Nielsen (Statens Serum Institut, Denmark) and Dr. Jorge Enrique Gomez Marin (COLOMBIA, South America). For detection of the B1 gene of T. gondii, the diagnostic method was optimized to amplify a 529 base pair (bp) repetitive sequence by PCR using DNA extracted from cat feces. Then a nested PCR was employed using internal primers to amplify a 102 bp from 391 bp product. The SAG2 gene was targeted at 5 different regions to amplify 5 amplicons. Genotype analysis was done using SAG2 sequence by Dr.
SUMMARY
132
Jorge Enrique Gomez Marin using 10 different markers. For amplification of ROP18, 54 sequences of the ROP18 gene retrieved from Genbank (National Center for Biotechnology Information (NCBI)) We used Geneious R8.1.6 software for sequence alignment and creating consensus sequence from all 54 ROP18 sequences. Primers were designed manually from the consensus sequence of ROP18. Primer pair namely ROP18-F 5‟ATCTAGAATGTTTTCGGTACAGCGG3‟ and ROP18-R Reverse 5‟TTCGAATTCTGTGTGGAGATGTTCC3‟ were designed to have restriction sites XbaI and HindIII respectively. The rop18 sequence was first cloned in pGMT easy vector system and then subcloned in pET28. BL21 competent cells were transformed with pET28-ROP18 and rROP18 was expression using IPTG for induction. The rROP18 was quantified through protein quantification kit (BCA). The rROP18 was formulated into nanospheres using PLGA as coating material. The Swiss-Webster mice were inoculated either intranasal or subcutaneous with rROP18 with or without montanide as adjuvant 3 times with 2 weeks interval. The blood was collected 2 weeks after each immunization. The control groups were inoculated with PLGA I/n or montanide S/c. For western blotting, ROP18 protein was electrophoresed on SDS-PAGE and blots were immune-blotted with the sera of immunized or infected mice. Bound antibodies were detected through Goat anti-mouse IgG–alkaline phosphatase conjugated. For evaluation of humoral response, ELISA plate was coated overnight at 4°C with rROP18 protein at 5μg/ml in 50mM sodium carbonate buffer (pH 9.6) @ 100 μl/ well. The absorbance of each sample was measured at OD 405 nm using ELISA (Bio-Tek, E-800, USA). Comparisons of quantitative values in the different groups were performed using ANOVA test, after checking the homogeneity of variances. Comparisons between groups for the antibody titre were performed by Dunn multiple range tests test. Comparisons were considered significant when a probability of equality was less than 5% (P<0.05). It was observed that rROP18 in nanospheres administered intranasal elicited
SUMMARY
133
elevated responses of specific intestinal IgA and IgG2a as compared to other groups inoculated intranasally rROP18 alone or injected subcutaneously rROP18 adjuvanted in montanide. It was concluded that nanospheres of ROP18 would be a non-invasive approach to develop vaccination against toxoplasmosis. Further experiments are needed to conclude the cellular response of these nanospheres in a chronic mouse model. Availability: Items available for loan: UVAS Library [Call number: 2680-T] (1).
7.
Epidemiology And Control Of Gastro-Intestinal Nematodes Of Large Ruminants In Balochistan
by Muhammad Ramzan (2009-VA-653) | Dr. Nisar Ahmad | Prof. Dr. Muhammad Azam Kakar | Prof. Dr. Kamran Ashraf | Prof. Dr. Aneela Khurram.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: The main area of research in this study was to assess the prevalence, hematological aspects
of Bovine nematodiasis. Three main experiments were conducted to highlight the objectives of
the present research study.
The first experiment was conducted to find out the prevalence of large ruminants major
nematodes for one year. For this purpose buffalo and cattle of either sexes and between < 1 year
to > 2 years of age were selected from two sites i.e., Quetta and Qilla Abdullah. Fecal analysis of
these cattle and buffalo showed overall higher (33.99%) nematodes prevalence recorded in buffalo
in Quetta, (27.99%) in cattle at Qilla Abdullah followed by in cattle at Quetta (26.66%). Five
nematode infection was recorded in all two experimental sites with higher prevalence of
Haemonchus contortus in buffalo at Quetta and Ostertgia ostertagi in cattle at Quetta and Qilla
Abdullah. The buffalo and cattle of < 1 year presented higher nematodes prevalence than 1-2 years
and > 2 years. The female buffalo and cattle were infected with nematodes prevalence higher
than male animals. These five nematodes were prevalent almost throughout the year, however a
peak infection was recorded during August and September in cattle and October in buffalo. The
high temperature, rainfall and humidity during these months may be predisposing factor of higher
prevalence. Mostly the level of nematodes infection was low(< 800 EPG) and did not seriously
impaired the buffalo and cattle productivity.
Second experiment on assessing the comparative efficacy of anthelmintics (Levamisole,
Oxafendazole and Ivermectin) against cattle and buffalo nematodes were conducted at Govt and
private farms. The results showed that Ivermectin than Oxfendazole were found effective against
cattle and buffalo nematodes. The higher (89-100%) reduction of EPG were recorded in cattle and
87
buffalo calves treated with Ivermectin followed by Oxfendazole (86-100%), Levmisole (88-
100%).
Third experiment was conducted to determine the hematological values in healthy and
nematodes infected animals. Different hematological parameters i.e., TEC, TLC, Hb estimation,
were determined. The results showed that overall low Hemoglobin estimation and RBC were
recorded in nematodes infected animals than healthy, while higher WBC were recorded in
nematodes infected animals than healthy. The Lymphocytes and Neutrophil and Monocytes were
higher in some nematodes and lower in other, while higher mean Eosinophil counts was recorded
in all nematodes infected animals than healthy animals. Availability: Items available for loan: UVAS Library [Call number: 2730-T] (1).
8.
Epidemiology, Molecular Detection, Zoonotic Potential, Heamatology And Chemotherapy Of Cryptosporidiosis In Small Ruminants In Southern Khyber Pakhtunkhwa, Pakistan
by Naimat Ullah Khan (2011-VA-516) | Dr. Muhammad Hassan Saleem | Prof. Dr. Aneela Zameer Durrani | Dr. Nisar Ahmad.
Material type: Book; Literary form:
not fiction
Publisher: 2017Dissertation note: Cryptosporidiosis is one of the most important parasitic enteric protozoan infection affecting all vertebrates. The current study was designed to determine the percent prevalence of cryptosporidiosis in small ruminants and humans along with associated risk factors.
An overall highest percent prevalence of cryptosporidiosis recorded in all four categories of small ruminants were 27.22%, 20.56%, 18.33% and 12.22% in lambs, kids, Sheep and goats respectively.
In the current study, 21.55%, 18.33% and15% prevalence of the Cryptosporidium infection was recorded in sheep in District Kohat, Bannu and Lakki Marwat respectively. In the present study, the highest month wise percent prevalence in sheep, was observed in the month of August (36.66%) followed by April (26.66%), June (26.66%), May, July and September (23.33%), February (10.66%), March (10%), November (10%) while the lowest percent prevalence was observed in the month of December and January (6.66%). In sheep, season wise percent prevalence was also studied where highest prevalence was recorded in summer and autumn season (23.33%), followed by spring (20%) while the lowest percent prevalence was found in the winter season (10%). In sheep, age wise percent prevalence was also studied where highest percent prevalence was found at the age of 1 year (22.38%) followed by 1-2 years (18.03%) while the lowest at the age of 2-3 years (13.46%). In sheep, sex wise percent prevalence was also documented where highest percent prevalence was recorded in female (18.80%) followed by male (17.02%) where lowest percent prevalence was recorded.
In goats, the percent prevalence of the Cryptosporidium infection was also studied in three selected areas where recorded 6.66%, 11.66% and 18.3% prevalence in District Bannu, Lakki Marwat and Kohat respectively. Similarly, in goats, overall highest month wise percent
Summary
154
prevalence was recorded in the month of August (30%), followed by July (23.33%), June (20%), May (16.66%), March and September (13.33%), April and November (10%), January, February and October (3.33%) while the lowest percent prevalence was recorded in December (0%). In the current study, the season wise prevalence was also studied in goats where highest percent prevalence was recorded in the summer season (20.83%), followed by spring (13.33%), autumn (11.66%) while the lowest prevalence was observed in winter season (3.33%). The highest age wise percent prevalence was recorded at the age of 1 year (18.58%) followed by 1-2 years (10.20%) while the lowest at the age of 2-3 years or above (5.95%). According to the sex wise percent prevalence, the highest percent prevalence was recorded in male (12.30%) while the lowest in females (12.17%).
The overall highest percent prevalence of the Cryptosporidium infection was also recorded in lambs in three areas where 33.33%, 25% and 23.33% prevalence was recorded in Kohat, Lakki Marwat and Bannu respectively. The highest month wise percent prevalence was recorded in the month of August (46.6%), followed by other months of the year such as July (40%), April, May and June (30%), September and October (26.66%), November and January (20%) while the lowest in the month of February and December (16.66%) in lambs. The Season wise percent prevalence was recorded in lambs where highest percent prevalence was recorded in summer season (36.66 %), followed by spring and autumn (26.66%) while the lowest in winter season (18.33%). According to the age wise percent prevalence in lambs, the highest prevalence was recorded at the age of 1-15 days (38.09%) followed by 16-30 days (29.41%) while the lowest at the age of 31-60 days or above (15.15%). In lambs, the highest sex wise percent prevalence was recorded in females (31.18%) while the lowest percent prevalence was observed in males (22.98%).
Summary
155
In kids, overall highest percent prevalence was 20.55% recorded in three selected districts where the highest prevalence was recorded in District Kohat (23.33%), followed by District Bannu (20%) while the lowest in District Lakki Marwat (18.33%). In kids the month wise percent prevalence was also studied where the highest percent prevalence was recorded in May and August (33.33%), followed by June, July and September (26.66%), March, April and October (20%), November and December (13.33%) while the lowest percent prevalence was recorded in the month of the January (6.66%). The Season wise percent prevalence was also recorded in kids, where the highest percent prevalence was observed in the summer season (30%), followed by autumn (23.33%), spring (20%) while the lowest prevalence was recorded in winter season (10%). The highest age wise percent prevalence in kids was also recorded at the age of ≤1-15 days (33.92%), followed by 16-30 days (15.38%) while the lowest at the age of ≥31-60 days or above (13.55%). Sex wise percent prevalence was also determined in goat kids where, the highest percent prevalence was recorded in female (20.98%) followed by male kids (19.19%).
To conduct molecular study, 360 fecal samples of sheep were analyzed for presence of the Cryptosporidium oocysts through simple microscopic method first then confirmed by PCR. DNA was extracted with the help of DNA extraction kit (Made in USA, GFC vivantis). The targeted gene of parasite was 18s rRNA which result in amplification of a segment of genomic DNA at 435 bp. The following primers sequence was used for Forward primer: (5-AAGCTCGTAGTTGGATTTCTG- and reverse primers (5-TAAGGTGCTGAAGGAGTAAGG-3. An overall molecular percent prevalence of the Cryptosporidium infection was 24.99% in sheep in three selected zones of southern KPK. The highest molecular percent prevalence was 31.66%, 25% and 18.33% in District Kohat, Bannu and Lakki Marwat respectively.
Summary
156
The highest season wise molecular percent prevalence was also recorded where the highest percent prevalence was recorded in the summer (33.33%), followed by autumn (30%), spring (26.66%) while the lowest in the winter season (13.33%). Molecular percent prevalence was higher in females (27.08%) than male (25.53%). On the basis of environmental factors, overall the highest percent prevalence was recorded in the month of August where highest ambient temperature, relative humidity and heavy rain fall was recorded.
To find out Zoonotic aspect of the Cryptosporidium infection, the overall highest percent prevalence was recorded in children (16.66%), followed by adults (5.55%).
The highest percent prevalence was recorded in diarrhoeic children where direct contact with small ruminants was observed while the lowest prevalence was recorded in those children where no direct or indirect contact was observed.
To conduct the therapeutic trials, a total of 50 goats were selected of the same weight and age that were naturally infected by Cryptosporidium under field conditions. All the goats were placed under same feeding and management conditions and randomly divided into five groups such as A, B, C, D and E. All animals in groups A, B, C and D were treated with Azithromycin (10mg/kg b.wt), Metronidazole (50mg/Kg b.wt), Allium sativum (50mg/Kg b.wt) and Paromomycin (100mg/kg b.wt) respectively while Group-E was placed as a positive control group. The highest percent efficacy in reduction of OPG was shown by different drugs such as Paromomycine (91.77%) followed by Metronidazole (78.20%), Allium sativum (77.00%) while the lowest percent efficacy was shown by Azithromycin (59.29%). On the basis of hematological study, lower lymphocytes count was (48.39%) recorded in non-infected animals while higher (54.33%) count was recorded in infected animals. Similarly higher eosinophil count was (6.73%) recorded in infected group while lower (50 %) counts were recorded in non-
Summary
157
infected group. Hb level was higher in infected group than healthy animals. PCV level was higher (42.94%) in infected animals while low (34.62%) in healthy animals. Biochemical analysis of the serum showed, higher quantity of total protein, albumin, ALP, Sodium, Potassium, Chloride, Zinc, Copper, Urea and Creatinine was recorded in infected goats while lower quantity was observed in healthy goats. Availability: Items available for loan: UVAS Library [Call number: 2880-T] (1).